This shows you the differences between two versions of the page.
Both sides previous revisionPrevious revisionNext revision | Previous revisionNext revisionBoth sides next revision | ||
teachings:tuto_16s_microbial_analysis [2020/02/06 13:37] – olivier | teachings:tuto_16s_microbial_analysis [2020/09/09 09:45] – olivier | ||
---|---|---|---|
Line 1: | Line 1: | ||
==== 16S Microbial Analysis (with Galaxy) ==== | ==== 16S Microbial Analysis (with Galaxy) ==== | ||
- | This tutorial | + | __This |
- | * a computer (under Linux, Mac, Windows) with an internet connection | + | * a computer (under Linux, Mac, Windows) |
- | + | ||
- | | + | * To know what a fasta or fastq (fastaq = fq) file is |
- | + | <hidden Click here for the fasta format description> | |
- | {{ : | + | //Data in text format used to store nucleic acid sequences (such as DNA sequences) or protein sequences; may contain multiple sequences. FASTA files often start with a header line that may contain comments or other information. The rest of the file contains sequence data. Each sequence starts with a ">" |
- | + | < | |
- | * Create an account on one Galaxy server : \\ \\ https:// | + | |
- | + | ||
- | * To know what a fasta or fastq (fastaq = fq) file is : | + | |
- | + | ||
- | //Data in text format used to store nucleic acid sequences (such as DNA sequences) or protein sequences; may contain multiple sequences. FASTA files often start with a header line that may contain comments or other information. The rest of the file contains sequence data. Each sequence starts with a ">" | + | |
> | > | ||
TTGTCAGATTCACCAAAGTTGAAATGAAGGAAAAAATGCTAAGGGCAGCC | TTGTCAGATTCACCAAAGTTGAAATGAAGGAAAAAATGCTAAGGGCAGCC | ||
Line 19: | Line 14: | ||
ATCTCTCGGCAGAAACCCTACAGGCCAGAAGAGAGTGGGGGCCAATATT | ATCTCTCGGCAGAAACCCTACAGGCCAGAAGAGAGTGGGGGCCAATATT | ||
CATATTCTTAAAGAAAAGAATTTTCAACCCAGAATTTCATATCCAGCCAA | CATATTCTTAAAGAAAAGAATTTTCAACCCAGAATTTCATATCCAGCCAA | ||
- | </ | ||
- | |||
- | < | ||
> | > | ||
ATACGACYCTTATTGTTAGTATATAATTTATATGAAAACMAAAAATTATG | ATACGACYCTTATTGTTAGTATATAATTTATATGAAAACMAAAAATTATG | ||
Line 28: | Line 20: | ||
</ | </ | ||
- | * Start this tutrorial | + | </ |
+ | \\ | ||
+ | * an access to a Galaxy website server, including usual tools for metagenomic analysis | ||
+ | |||
+ | See what is the Galaxy project: [[https:// | ||
+ | |||
+ | {{ : | ||
+ | //Example of the main display page of Galaxy (using a browser)// | ||
+ | |||
+ | => __3 possibilities to get access to a Galaxy server__: | ||
+ | |||
+ | | ||
+ | |||
+ | Many public servers are available. Here a list of servers including metaG tools: | ||
+ | |||
+ | https:// | ||
+ | |||
+ | __pro__: no installation required, usable directly \\ | ||
+ | __cons__: Some limitations and slow (or super slow) when running big computations | ||
+ | |||
+ | | ||
+ | |||
+ | | ||
+ | |||
+ | __pro__: no installation required, usable directly\\ | ||
+ | __cons__: should to be faster than previous servers, but depending the number of students connected at the same time ! | ||
+ | |||
+ | | ||
+ | |||
+ | - install " | ||
+ | - install a Galaxy server into Docker and run docker, by typing this single command: | ||
+ | |||
+ | < | ||
+ | |||
+ | Wait a loooong time before it starts : 5-10 Go to download the first time! => do it at home using a fast internet connection. Further starts are faster (re type the same command to enable the server). | ||
+ | |||
+ | - Go here in your browser : http:// | ||
+ | |||
+ | __pro__: fast server, depending of you computer power. Reusable.\\ | ||
+ | __cons__: harder (and long) to install. Take some disk space onto your hard drive. | ||
+ | |||
+ | * Create a personal account into Galaxy (top-right menu) | ||
+ | |||
+ | | ||