Differences

This shows you the differences between two versions of the page.

--- teachings:tuto_16s_microbial_analysis [2020/02/07 16:59] – olivier
+++ teachings:tuto_16s_microbial_analysis [2020/09/08 15:47] – olivier
@@ Line 1: / Line 1: @@
 ==== 16S Microbial Analysis (with Galaxy) ====
-This tutorial required:
+__This tutorial required__:
-  * a computer (under Linux, Mac, Windows) with an internet connection
+  * a computer (under Linux, Mac, Windows) **with** an internet connection
-  * an access to a Galaxy website server (many are available freely) \\ \\ => See what is the Galaxy project: [[https://en.wikipedia.org/wiki/Galaxy_%28computational_biology%29|Wikipedia]] or [[https://usegalaxy.org/|Official website]]
+  * To know what a fasta or fastq (fastaq = fq) file is
+ <hidden Click here for fasta format description>
-{{ :teachings:galaxy.png?400 |}}
+//Data in text format used to store nucleic acid sequences (such as DNA sequences) or protein sequences; may contain multiple sequences. FASTA files often start with a header line that may contain comments or other information. The rest of the file contains sequence data. Each sequence starts with a ">" symbol followed by the name of the sequence. The rest of the line describes the sequence and the remaining lines contain the sequence itself.// \\Example : \\ \\ <nowiki>
-  * Create an account on of these Galaxy server : \\ \\ https://usegalaxy.eu/login\\ https://nanopore.usegalaxy.eu/login\\   https://ecology.usegalaxy.eu/login \\ \\ google it for others servers !
-  * To know what a fasta or fastq (fastaq = fq) file is :
-//Data in text format used to store nucleic acid sequences (such as DNA sequences) or protein sequences; may contain multiple sequences. FASTA files often start with a header line that may contain comments or other information. The rest of the file contains sequence data. Each sequence starts with a ">" symbol followed by the name of the sequence. The rest of the line describes the sequence and the remaining lines contain the sequence itself.// Example : \\ \\ <nowiki>
 >human_T1 (UCSC April 2002 chr7:115977709:)
 TTGTCAGATTCACCAAAGTTGAAATGAAGGAAAAAATGCTAAGGGCAGCC
@@ Line 28: / Line 22: @@
 </nowiki>
-  * Start this tutrorial : [[https://galaxyproject.github.io/training-material/topics/metagenomics/tutorials/mothur-miseq-sop-short/tutorial.html|here]]
+</hidden>
+\\
+  * an access to a Galaxy website server (many are available freely) \\ \\ => See what is the Galaxy project: [[https://en.wikipedia.org/wiki/Galaxy_%28computational_biology%29|Wikipedia]] or [[https://usegalaxy.org/|Official website]]
+{{ :teachings:galaxy.png?400 |}}
+  * Create an account on of these Galaxy server : \\ \\ https://usegalaxy.org.au/login \\ https://usegalaxy.eu/login\\ https://nanopore.usegalaxy.eu/login\\   https://ecology.usegalaxy.eu/login \\ * google it for others servers !
+  * => Start this tutorial : [[https://galaxyproject.github.io/training-material/topics/metagenomics/tutorials/mothur-miseq-sop-short/tutorial.html|here]]

bioinfomed

User Tools

Site Tools

Differences

Page Tools