This shows you the differences between two versions of the page.
Both sides previous revisionPrevious revisionNext revision | Previous revisionNext revisionBoth sides next revision | ||
teachings:tuto_16s_microbial_analysis [2020/02/07 16:59] – olivier | teachings:tuto_16s_microbial_analysis [2020/09/08 15:47] – olivier | ||
---|---|---|---|
Line 1: | Line 1: | ||
==== 16S Microbial Analysis (with Galaxy) ==== | ==== 16S Microbial Analysis (with Galaxy) ==== | ||
- | This tutorial | + | __This |
- | * a computer (under Linux, Mac, Windows) with an internet connection | + | * a computer (under Linux, Mac, Windows) |
- | + | ||
- | | + | * To know what a fasta or fastq (fastaq = fq) file is |
- | + | <hidden Click here for fasta format description> | |
- | {{ : | + | //Data in text format used to store nucleic acid sequences (such as DNA sequences) or protein sequences; may contain multiple sequences. FASTA files often start with a header line that may contain comments or other information. The rest of the file contains sequence data. Each sequence starts with a ">" |
- | + | ||
- | * Create an account on of these Galaxy server : \\ \\ https:// | + | |
- | + | ||
- | * To know what a fasta or fastq (fastaq = fq) file is : | + | |
- | + | ||
- | //Data in text format used to store nucleic acid sequences (such as DNA sequences) or protein sequences; may contain multiple sequences. FASTA files often start with a header line that may contain comments or other information. The rest of the file contains sequence data. Each sequence starts with a ">" | + | |
> | > | ||
TTGTCAGATTCACCAAAGTTGAAATGAAGGAAAAAATGCTAAGGGCAGCC | TTGTCAGATTCACCAAAGTTGAAATGAAGGAAAAAATGCTAAGGGCAGCC | ||
Line 28: | Line 22: | ||
</ | </ | ||
- | * Start this tutrorial | + | </ |
+ | \\ | ||
+ | |||
+ | * an access to a Galaxy website server (many are available freely) \\ \\ => See what is the Galaxy project: [[https:// | ||
+ | |||
+ | {{ : | ||
+ | |||
+ | * Create an account on of these Galaxy server : \\ \\ https:// | ||
+ | |||
+ | |||
+ | |||
+ | | ||