This shows you the differences between two versions of the page.
Both sides previous revisionPrevious revisionNext revision | Previous revisionNext revisionBoth sides next revision | ||
teachings:tuto_16s_microbial_analysis [2020/09/08 15:47] – olivier | teachings:tuto_16s_microbial_analysis [2020/09/10 11:11] – olivier | ||
---|---|---|---|
Line 6: | Line 6: | ||
| | ||
* To know what a fasta or fastq (fastaq = fq) file is | * To know what a fasta or fastq (fastaq = fq) file is | ||
- | < | + | < |
- | //Data in text format used to store nucleic acid sequences (such as DNA sequences) or protein sequences; may contain multiple sequences. FASTA files often start with a header line that may contain comments or other information. The rest of the file contains sequence data. Each sequence starts with a ">" | + | //Data in text format used to store nucleic acid sequences (such as DNA sequences) or protein sequences; may contain multiple sequences. FASTA files often start with a header line that may contain comments or other information. The rest of the file contains sequence data. Each sequence starts with a ">" |
+ | < | ||
> | > | ||
TTGTCAGATTCACCAAAGTTGAAATGAAGGAAAAAATGCTAAGGGCAGCC | TTGTCAGATTCACCAAAGTTGAAATGAAGGAAAAAATGCTAAGGGCAGCC | ||
Line 13: | Line 14: | ||
ATCTCTCGGCAGAAACCCTACAGGCCAGAAGAGAGTGGGGGCCAATATT | ATCTCTCGGCAGAAACCCTACAGGCCAGAAGAGAGTGGGGGCCAATATT | ||
CATATTCTTAAAGAAAAGAATTTTCAACCCAGAATTTCATATCCAGCCAA | CATATTCTTAAAGAAAAGAATTTTCAACCCAGAATTTCATATCCAGCCAA | ||
- | </ | ||
- | |||
- | < | ||
> | > | ||
ATACGACYCTTATTGTTAGTATATAATTTATATGAAAACMAAAAATTATG | ATACGACYCTTATTGTTAGTATATAATTTATATGAAAACMAAAAATTATG | ||
Line 24: | Line 22: | ||
</ | </ | ||
\\ | \\ | ||
+ | * an access to a Galaxy website server, including usual tools for metagenomic analysis | ||
- | * an access to a Galaxy website server (many are available freely) \\ \\ => See what is the Galaxy project: [[https:// | + | See what is the Galaxy project: [[https:// |
{{ : | {{ : | ||
+ | //Example of the main display page of Galaxy (using a browser)// | ||
+ | |||
+ | => __3 possibilities to get access to a Galaxy server__: | ||
+ | |||
+ | | ||
+ | |||
+ | Many public servers are available. Here a list of servers including metaG tools: | ||
+ | |||
+ | https:// | ||
+ | |||
+ | __pro__: no installation required, usable directly \\ | ||
+ | __cons__: some limitations and slow (or super slow) when running big computations | ||
+ | |||
+ | | ||
+ | |||
+ | | ||
+ | |||
+ | __pro__: no installation required, usable directly\\ | ||
+ | __cons__: should to be faster than previous servers, but depending the number of students connected at the same time ! | ||
+ | |||
+ | | ||
+ | |||
+ | - install " | ||
+ | - install a Galaxy server into Docker and run docker, by typing this single command: | ||
+ | |||
+ | < | ||
+ | |||
+ | Wait a loooong time before it starts : 5-10 Go to download the first time! => do it at home using a fast internet connection. Further starts are faster (re type the same command to enable the server). | ||
- | * Create an account on of these Galaxy server | + | - Go here in your browser |
+ | __pro__: fast server, depending of you computer power. Reusable.\\ | ||
+ | __cons__: harder (and long) to install. Take some disk space onto your hard drive. | ||
+ | * Create a personal account into Galaxy (top-right menu) | ||
- | * => Start this tutorial : [[https:// | + | * Start this tutorial : [[http:// |