This shows you the differences between two versions of the page.
Both sides previous revisionPrevious revisionNext revision | Previous revision | ||
teachings:tuto_16s_microbial_analysis [2020/09/08 15:47] – olivier | teachings:tuto_16s_microbial_analysis [2022/10/13 14:12] (current) – olivier | ||
---|---|---|---|
Line 6: | Line 6: | ||
| | ||
* To know what a fasta or fastq (fastaq = fq) file is | * To know what a fasta or fastq (fastaq = fq) file is | ||
- | < | + | < |
- | //Data in text format used to store nucleic acid sequences (such as DNA sequences) or protein sequences; may contain multiple sequences. FASTA files often start with a header line that may contain comments or other information. The rest of the file contains sequence data. Each sequence starts with a ">" | + | Data in text format used to store nucleic acid sequences (such as DNA sequences) or protein sequences; may contain multiple sequences. FASTA files often start with a header line that may contain comments or other information. The rest of the file contains sequence data. Each sequence starts with a ">" |
- | > | + | |
- | TTGTCAGATTCACCAAAGTTGAAATGAAGGAAAAAATGCTAAGGGCAGCC | + | |
- | AGAGAGAGGTCAGGTTACCCACAAAGGGAAGCCCATCAGACTAACAGCG | + | |
- | ATCTCTCGGCAGAAACCCTACAGGCCAGAAGAGAGTGGGGGCCAATATT | + | |
- | CATATTCTTAAAGAAAAGAATTTTCAACCCAGAATTTCATATCCAGCCAA | + | |
- | </ | + | |
- | <nowiki> | + | //>human_T1 (UCSC April 2002 chr7: |
- | > | + | TTGTCAGATTCACCAAAGTTGAAATGAAGGAAAAAATGCTAAGGGCAGCC\\ |
- | ATACGACYCTTATTGTTAGTATATAATTTATATGAAAACMAAAAATTATG | + | AGAGAGAGGTCAGGTTACCCACAAAGGGAAGCCCATCAGACTAACAGCG\\ |
- | GCGGTATTTTAAGCTTTTCAGAGGAATTTGCTCTTTAATGGATAAAAC | + | ATCTCTCGGCAGAAACCCTACAGGCCAGAAGAGAGTGGGGGCCAATATT\\ |
- | CTAAATCTTACTAGAATTAGTAAAGCAGTTTGTATACCACT | + | CATATTCTTAAAGAAAAGAATTTTCAACCCAGAATTTCATATCCAGCCAA\\ |
- | </nowiki> | + | > |
+ | ATACGACYCTTATTGTTAGTATATAATTTATATGAAAACMAAAAATTATG\\ | ||
+ | GCGGTATTTTAAGCTTTTCAGAGGAATTTGCTCTTTAATGGATAAAAC\\ | ||
+ | CTAAATCTTACTAGAATTAGTAAAGCAGTTTGTATACCACT\\ \\ | ||
+ | // | ||
</ | </ | ||
\\ | \\ | ||
+ | * an access to a Galaxy website server, including usual tools for metagenomic analysis | ||
- | * an access to a Galaxy website server (many are available freely) \\ \\ => See what is the Galaxy project: [[https:// | + | See what is the Galaxy project: [[https:// |
{{ : | {{ : | ||
+ | //Example of the main display page of Galaxy (using a browser)// | ||
- | * Create an account on of these Galaxy | + | => __3 possibilities to get access to a Galaxy |
+ | | ||
+ | Many public Galaxy servers are available. Here a list of servers including the required metaG tools (//list updated November 2022//): | ||
- | | + | https:// |
+ | https:// | ||
+ | https:// | ||
+ | https:// | ||
+ | https:// | ||
+ | https:// | ||
+ | https:// | ||
+ | https:// | ||
+ | https:// | ||
+ | https:// | ||
+ | https:// | ||
+ | https:// | ||
+ | |||
+ | __pro__: no installation required, usable directly \\ | ||
+ | __cons__: some limitations and slow (or super slow) when running big computations | ||
+ | |||
+ | **2)** Use our local Galaxy server (IRCAN institute, in Pasteur tower) | ||
+ | |||
+ | | ||
+ | |||
+ | __pro__: no installation required, usable directly\\ | ||
+ | __cons__: should to be faster than previous servers, but depending the number of students connected at the same time ! | ||
+ | |||
+ | | ||
+ | |||
+ | - install " | ||
+ | - install a Galaxy server into Docker and run docker, by typing this single command: | ||
+ | |||
+ | < | ||
+ | |||
+ | Wait a loooong time before it starts : 5-10 Go to download the first time! => do it at home using a fast internet connection. Further starts are faster (re type the same command to enable the server). | ||
+ | |||
+ | - Go here in your browser : http:// | ||
+ | |||
+ | __pro__: fast server, depending of you computer power. Reusable.\\ | ||
+ | __cons__: harder (and long) to install. Take some disk space onto your hard drive. | ||
+ | |||
+ | -------- | ||
+ | then, | ||
+ | |||
+ | |||
+ | * Create a personal account into Galaxy (top-right menu) | ||
+ | |||
+ | * Start this tutorial : [[http:// | ||