Differences

This shows you the differences between two versions of the page.

--- teachings:tuto_16s_microbial_analysis [2020/09/08 16:15] – olivier
+++ teachings:tuto_16s_microbial_analysis [2020/09/11 09:44] – olivier
@@ Line 6: / Line 6: @@
   * To know what a fasta or fastq (fastaq = fq) file is
- <hidden Click here for fasta format description>
+ <hidden Click here for the fasta format description>
-//Data in text format used to store nucleic acid sequences (such as DNA sequences) or protein sequences; may contain multiple sequences. FASTA files often start with a header line that may contain comments or other information. The rest of the file contains sequence data. Each sequence starts with a ">" symbol followed by the name of the sequence. The rest of the line describes the sequence and the remaining lines contain the sequence itself.// \\Example : \\ \\ <nowiki>
+//Data in text format used to store nucleic acid sequences (such as DNA sequences) or protein sequences; may contain multiple sequences. FASTA files often start with a header line that may contain comments or other information. The rest of the file contains sequence data. Each sequence starts with a ">" symbol followed by the name of the sequence. The rest of the line describes the sequence and the remaining lines contain the sequence itself.// \\ \\ Example of a fasta file including 2 sequences:\\ \\
+<nowiki>
 >human_T1 (UCSC April 2002 chr7:115977709:)
 TTGTCAGATTCACCAAAGTTGAAATGAAGGAAAAAATGCTAAGGGCAGCC
@@ Line 13: / Line 14: @@
 ATCTCTCGGCAGAAACCCTACAGGCCAGAAGAGAGTGGGGGCCAATATT
 CATATTCTTAAAGAAAAGAATTTTCAACCCAGAATTTCATATCCAGCCAA
-</nowiki>
-<nowiki>
 >human_T2 (UCSC April 2002 chr5:11977710:)
 ATACGACYCTTATTGTTAGTATATAATTTATATGAAAACMAAAAATTATG
@@ Line 24: / Line 22: @@
 </hidden>
 \\
+  * an access to a Galaxy website server, including usual tools for metagenomic analysis
-  * an access to a Galaxy website server including usual tools for metagenomic analysis
 See what is the Galaxy project: [[https://en.wikipedia.org/wiki/Galaxy_%28computational_biology%29|Wikipedia]] or [[https://usegalaxy.org/|Official website]]
 {{ :teachings:galaxy.png?400 |}}
-//Main display of Galaxy (using a browser)//
+//Example of the main display page of Galaxy (using a browser)//
 => __3 possibilities to get access to a Galaxy server__:
@@ Line 41: / Line 38: @@
 __pro__: no installation required, usable directly \\
-__cons__: slow (or super slow) when running big computations
+__cons__: some limitations and slow (or super slow) when running big computations
  **2)** Use our local Galaxy server (IRCAN institute, in Pasteur tower)
- http://wolverine.unice.fr:8080/
+ http://galaxy-metag.ircan.org/ (alternate link: http://wolverine.unice.fr:8080/)
 __pro__: no installation required, usable directly\\
-__cons__: should to be faster than previous servers, but depending the numbers of students connected at the same time !
+__cons__: should to be faster than previous servers, but depending the number of students connected at the same time !
  **3)** Install Galaxy on your own computer
@@ Line 66: / Line 63: @@
   * Create a personal account into Galaxy (top-right menu)
-  * Start this tutorial : [[https://galaxyproject.github.io/training-material/topics/metagenomics/tutorials/mothur-miseq-sop-short/tutorial.html|here]]
+  * Start this tutorial : [[http://www.bioinfomed.fr/__Teachings/tuto_Galaxy_metaG/index.html|Here]] //([[https://galaxyproject.github.io/training-material/topics/metagenomics/tutorials/mothur-miseq-sop-short/tutorial.html|alternative link]])//

bioinfomed

User Tools

Site Tools

Differences

Page Tools