This shows you the differences between two versions of the page.
Both sides previous revisionPrevious revisionNext revision | Previous revisionNext revisionBoth sides next revision | ||
teachings:tuto_16s_microbial_analysis [2020/09/08 16:15] – olivier | teachings:tuto_16s_microbial_analysis [2020/10/09 10:13] – olivier | ||
---|---|---|---|
Line 6: | Line 6: | ||
| | ||
* To know what a fasta or fastq (fastaq = fq) file is | * To know what a fasta or fastq (fastaq = fq) file is | ||
- | < | + | < |
- | //Data in text format used to store nucleic acid sequences (such as DNA sequences) or protein sequences; may contain multiple sequences. FASTA files often start with a header line that may contain comments or other information. The rest of the file contains sequence data. Each sequence starts with a ">" | + | //Data in text format used to store nucleic acid sequences (such as DNA sequences) or protein sequences; may contain multiple sequences. FASTA files often start with a header line that may contain comments or other information. The rest of the file contains sequence data. Each sequence starts with a ">" |
+ | < | ||
> | > | ||
TTGTCAGATTCACCAAAGTTGAAATGAAGGAAAAAATGCTAAGGGCAGCC | TTGTCAGATTCACCAAAGTTGAAATGAAGGAAAAAATGCTAAGGGCAGCC | ||
Line 13: | Line 14: | ||
ATCTCTCGGCAGAAACCCTACAGGCCAGAAGAGAGTGGGGGCCAATATT | ATCTCTCGGCAGAAACCCTACAGGCCAGAAGAGAGTGGGGGCCAATATT | ||
CATATTCTTAAAGAAAAGAATTTTCAACCCAGAATTTCATATCCAGCCAA | CATATTCTTAAAGAAAAGAATTTTCAACCCAGAATTTCATATCCAGCCAA | ||
- | </ | ||
- | |||
- | < | ||
> | > | ||
ATACGACYCTTATTGTTAGTATATAATTTATATGAAAACMAAAAATTATG | ATACGACYCTTATTGTTAGTATATAATTTATATGAAAACMAAAAATTATG | ||
Line 24: | Line 22: | ||
</ | </ | ||
\\ | \\ | ||
- | + | | |
- | | + | |
See what is the Galaxy project: [[https:// | See what is the Galaxy project: [[https:// | ||
{{ : | {{ : | ||
- | //Main display of Galaxy (using a browser)// | + | //Example of the main display |
=> __3 possibilities to get access to a Galaxy server__: | => __3 possibilities to get access to a Galaxy server__: | ||
Line 41: | Line 38: | ||
__pro__: no installation required, usable directly \\ | __pro__: no installation required, usable directly \\ | ||
- | __cons__: slow (or super slow) when running big computations | + | __cons__: |
| | ||
- | | + | |
__pro__: no installation required, usable directly\\ | __pro__: no installation required, usable directly\\ | ||
- | __cons__: should to be faster than previous servers, but depending the numbers | + | __cons__: should to be faster than previous servers, but depending the number |
| | ||
Line 63: | Line 60: | ||
__pro__: fast server, depending of you computer power. Reusable.\\ | __pro__: fast server, depending of you computer power. Reusable.\\ | ||
__cons__: harder (and long) to install. Take some disk space onto your hard drive. | __cons__: harder (and long) to install. Take some disk space onto your hard drive. | ||
+ | |||
+ | -------- | ||
+ | then, | ||
+ | |||
* Create a personal account into Galaxy (top-right menu) | * Create a personal account into Galaxy (top-right menu) | ||
- | * Start this tutorial : [[https:// | + | * Start this tutorial : [[http:// |