http://bioinfomed.fr/ 2026-04-19T22:06:36+00:00 http://bioinfomed.fr/ http://bioinfomed.fr/lib/exe/fetch.php?media=wiki:dokuwiki.svg text/html 2025-01-30T11:10:06+00:00 Anonymous (anonymous@undisclosed.example.com) http://bioinfomed.fr/doku.php?id=teachings:install_dicom_c&rev=1738235406&do=diff Aide pour l'installation de la bibliothèque "DicomSDL" Pour ceux qui souhaitent utiliser la bibliothèque “dicomSDL” (<http://code.google.com/p/dicomsdl>) La documentation pour l'installation n'est pas très claire. Voici les étapes pour démarrer rapidement sous Windows. * text/html 2025-01-30T11:10:06+00:00 Anonymous (anonymous@undisclosed.example.com) http://bioinfomed.fr/doku.php?id=teachings:ngs_assemblies_cap3&rev=1738235406&do=diff * some data * One .fasta file + corresponding .qual file [ .zip] or [.tar.gz] * CAP3 assembler * * A version of CAP3 for a 64-bit Linux system with an Intel processor: [download tar file] * A version of CAP3 for a 32-bit Linux system with an Intel processor[ download tar file] * A version of CAP3 for a 64-bit Linux system with an Opterron processor: text/html 2025-11-17T09:17:17+00:00 Anonymous (anonymous@undisclosed.example.com) http://bioinfomed.fr/doku.php?id=teachings:ngs_assemblies&rev=1763371037&do=diff Tutorial: NGS assemblies Aims This tutorial will address several assembly issues: quality control, assembly, mapping and scaffolding. The assembly can be done with Velvet or Minia. Requirement * You need to use a virtual machine (VM). This VM is downloadable text/html 2025-01-30T11:10:06+00:00 Anonymous (anonymous@undisclosed.example.com) http://bioinfomed.fr/doku.php?id=teachings:ngs_trimming&rev=1738235406&do=diff * Data files to upload in Galaxy * * [sample1-f.fq.gz] * [sample1-r.fq.gz] * [sample2-f.fq.gz] * [sample2-r.fq.gz] text/html 2025-01-30T11:10:05+00:00 Anonymous (anonymous@undisclosed.example.com) http://bioinfomed.fr/doku.php?id=teachings:projet_dora_2013&rev=1738235405&do=diff Manipulation des fichiers Dicom L'objectif du projet est de réaliser un logiciel simple permettant à un utilisateur non-informaticien d'effectuer des recherches d'informations ou de modifier celles-ci sur un ou plusieurs fichiers Dicom. Pour cela, il vous faudra : text/html 2025-01-30T11:10:06+00:00 Anonymous (anonymous@undisclosed.example.com) http://bioinfomed.fr/doku.php?id=teachings:projet_gbm&rev=1738235406&do=diff Pour tous les projets - Le projet est à rendre avant le dimanche 2 février, en envoyant un fichier archivé (zip, rar, ...) unique (à olivier.croce@gmail.com) contenant : - un rapport présentant votre projet, avec présentation du problème, objectifs et solutions proposées, algorithme récapitulatif , schémas/screenshots et conclusion. text/html 2025-10-29T09:15:09+00:00 Anonymous (anonymous@undisclosed.example.com) http://bioinfomed.fr/doku.php?id=teachings:teachings_bim&rev=1761729309&do=diff Master of Life and Health Sciences - Sciences faculty M1 & M2 - BBC (Bioinformatique et Biologie Computationnelle) + others UE Omiques, UE Atelier Omiques Objectives of teachings Basis in Metagenomics and Barcoding. Genomes assembling Prerequisites text/html 2025-01-30T11:10:06+00:00 Anonymous (anonymous@undisclosed.example.com) http://bioinfomed.fr/doku.php?id=teachings:teachings_dora&rev=1738235406&do=diff Faculty of Sciences - University of Nice Sophia-Antipolis Informatique - Licence 3 pro. - DORA (DOsimetrie et RAdioprotection médicale) Emploi du temps 2016-2017 (prévisionnel) * 1/8 (+3h) - Lundi 10 Octobre (14h-17h) - Le codage de l'information text/html 2025-01-30T11:10:06+00:00 Anonymous (anonymous@undisclosed.example.com) http://bioinfomed.fr/doku.php?id=teachings:teachings_gbm&rev=1738235406&do=diff Faculty of Sciences - University of Nice Sophia-Antipolis Informatique - Master 1 pro. - GBM (Génie Bio Medical) Ce module propose d'apporter les bases informatiques nécessaires au métier d'ingénieur en biomédical. Il se compose de 28 heures d'enseignements réparties en proportions égales entre cours magistraux et travaux dirigés. Ces enseignements ne demandent pas de pré-requis particuliers en informatique, mais l'étudiant devra toutefois être à l'aise avec l'outil informatique. Les concepts … text/html 2026-03-18T12:43:27+00:00 Anonymous (anonymous@undisclosed.example.com) http://bioinfomed.fr/doku.php?id=teachings:teachings_isem&rev=1773837807&do=diff Master EADE - Introduction to Python Objectives of Teachings This 18-hour module provides an introduction to the Python programming language. Python is a modern, powerful and very accessible programming language for non-specialists. Today, it is used in many fields, both in the research world or in companies. It is a language that goes to the essential, minimizing technical constraints which makes it an ideal language to learn programming. It can help to solve a problem in a few lines of code… text/html 2026-03-17T13:56:51+00:00 Anonymous (anonymous@undisclosed.example.com) http://bioinfomed.fr/doku.php?id=teachings:teachings_list&rev=1773755811&do=diff Teachings EUR Life (Life and Health Sciences) - University Côte d'Azur Master 1 & 2, BBC (Bioinformatique et Biologie Computationnelle) * Where: Valrose campus and/or Pasteur campus * Introduction to NGS & MetaGenomics: courses * MetaGenomics (16S microbioal analysis): tutorial text/html 2026-01-21T15:25:30+00:00 Anonymous (anonymous@undisclosed.example.com) http://bioinfomed.fr/doku.php?id=teachings:teachings_medicine&rev=1769009130&do=diff L2, L3, M1 - Medicine UE 15 M1 recherche - Microbiology Etude des Microbiotes et Dysbiose : impact en pathologie humaine Objectives of Teachings Séquençage haut débit, métagénomique et applications à l'étude des microbiotes Prerequisites text/html 2025-01-30T11:10:06+00:00 Anonymous (anonymous@undisclosed.example.com) http://bioinfomed.fr/doku.php?id=teachings:teachings_timone&rev=1738235406&do=diff URMITE lab - Marseille / La Timone Learnings - Introduction to Bioinformatics Place [Click to enlarge] Faculty of Medicine, Marseille. Main building, red wing, 1st floor, room 11. Last planning (session 2) Next Bioinformatics Learnings : March 2015 * Tuesday, March 17. 9h-12h. Sequence Analysis / Retrieved sequences - Blast ( text/html 2025-01-30T11:10:06+00:00 Anonymous (anonymous@undisclosed.example.com) http://bioinfomed.fr/doku.php?id=teachings:teachings&rev=1738235406&do=diff => Teacher - Olivier Croce School of Economics and Business - (ISEM) - University of Nice Sophia-Antipolis Introduction to Python - Master 1 Economy (EE - Economic Expertise / SIED - Social Interactions and Economic Dynamics) Objectives of Teachings This 18-hour module provides an introduction to the Python programming language. text/html 2026-01-29T09:28:01+00:00 Anonymous (anonymous@undisclosed.example.com) http://bioinfomed.fr/doku.php?id=teachings:tuto_16s_microbial_analysis&rev=1769678881&do=diff 16S Microbial Analysis (with Galaxy) This tutorial required: * a computer (under Linux, Mac, Windows) with an internet connection * To know what a fasta or fastq (fastaq = fq) file is “” >human_T1 (UCSC April 2002 chr7:115977709:) TTGTCAGATTCACCAAAGTTGAAATGAAGGAAAAAATGCTAAGGGCAGCC