User Tools

Site Tools


Differences

This shows you the differences between two versions of the page.

Link to this comparison view

Both sides previous revision Previous revision
Next revision
Previous revision
teachings:tuto_16s_microbial_analysis [2020/02/07 17:21]
olivier
teachings:tuto_16s_microbial_analysis [2020/09/11 09:44] (current)
olivier
Line 1: Line 1:
 ==== 16S Microbial Analysis (with Galaxy) ==== ==== 16S Microbial Analysis (with Galaxy) ====
  
-This tutorial required:+__This tutorial required__:
  
-  * a computer (under Linux, Mac, Windows) with an internet connection +  * a computer (under Linux, Mac, Windows) **with** an internet connection 
- +   
-  * an access to a Galaxy website server (many are available freely) \\ \\ => See what is the Galaxy project: [[https://en.wikipedia.org/wiki/Galaxy_%28computational_biology%29|Wikipedia]] or [[https://usegalaxy.org/|Official website]] +  * To know what a fasta or fastq (fastaq = fq) file is 
- + <hidden Click here for the fasta format description>  
-{{ :teachings:galaxy.png?400 |}} +//Data in text format used to store nucleic acid sequences (such as DNA sequences) or protein sequences; may contain multiple sequences. FASTA files often start with a header line that may contain comments or other information. The rest of the file contains sequence data. Each sequence starts with a ">" symbol followed by the name of the sequence. The rest of the line describes the sequence and the remaining lines contain the sequence itself.// \\ \\ Example of a fasta file including 2 sequences:\\ \\ 
- +<nowiki>
-  * Create an account on of these Galaxy server : \\ \\ https://usegalaxy.org.au/login \\ https://usegalaxy.eu/login\\ https://nanopore.usegalaxy.eu/login\\   https://ecology.usegalaxy.eu/login \\ * google it for others servers ! +
- +
-  * To know what a fasta or fastq (fastaq = fq) file is : +
- +
-//Data in text format used to store nucleic acid sequences (such as DNA sequences) or protein sequences; may contain multiple sequences. FASTA files often start with a header line that may contain comments or other information. The rest of the file contains sequence data. Each sequence starts with a ">" symbol followed by the name of the sequence. The rest of the line describes the sequence and the remaining lines contain the sequence itself.// Example : \\ \\ <nowiki>+
 >human_T1 (UCSC April 2002 chr7:115977709: >human_T1 (UCSC April 2002 chr7:115977709:
 TTGTCAGATTCACCAAAGTTGAAATGAAGGAAAAAATGCTAAGGGCAGCC TTGTCAGATTCACCAAAGTTGAAATGAAGGAAAAAATGCTAAGGGCAGCC
Line 19: Line 14:
 ATCTCTCGGCAGAAACCCTACAGGCCAGAAGAGAGTGGGGGCCAATATT ATCTCTCGGCAGAAACCCTACAGGCCAGAAGAGAGTGGGGGCCAATATT
 CATATTCTTAAAGAAAAGAATTTTCAACCCAGAATTTCATATCCAGCCAA CATATTCTTAAAGAAAAGAATTTTCAACCCAGAATTTCATATCCAGCCAA
-</nowiki> 
- 
-<nowiki> 
 >human_T2 (UCSC April 2002 chr5:11977710: >human_T2 (UCSC April 2002 chr5:11977710:
 ATACGACYCTTATTGTTAGTATATAATTTATATGAAAACMAAAAATTATG ATACGACYCTTATTGTTAGTATATAATTTATATGAAAACMAAAAATTATG
Line 28: Line 20:
 </nowiki> </nowiki>
  
-  * Start this tutrorial : [[https://galaxyproject.github.io/training-material/topics/metagenomics/tutorials/mothur-miseq-sop-short/tutorial.html|here]]+</hidden> 
 +\\ 
 +  * an access to a Galaxy website server, including usual tools for metagenomic analysis 
 + 
 +See what is the Galaxy project: [[https://en.wikipedia.org/wiki/Galaxy_%28computational_biology%29|Wikipedia]] or [[https://usegalaxy.org/|Official website]] 
 + 
 +{{ :teachings:galaxy.png?400 |}} 
 +//Example of the main display page of Galaxy (using a browser)// 
 + 
 +=> __3 possibilities to get access to a Galaxy server__: 
 + 
 + **1)** Use a free distant server  
 + 
 +Many public servers are available. Here a list of servers including metaG tools: 
 + 
 +https://usegalaxy.org.au/login \\ https://usegalaxy.eu/login\\ https://nanopore.usegalaxy.eu/login\\   https://ecology.usegalaxy.eu/login \\  
 + 
 +__pro__: no installation required, usable directly \\ 
 +__cons__: some limitations and slow (or super slow) when running big computations 
 + 
 + **2)** Use our local Galaxy server (IRCAN institute, in Pasteur tower) 
 + 
 + http://galaxy-metag.ircan.org/ (alternate link: http://wolverine.unice.fr:8080/
 + 
 +__pro__: no installation required, usable directly\\ 
 +__cons__: should to be faster than previous servers, but depending the number of students connected at the same time ! 
 + 
 + **3)** Install Galaxy on your own computer 
 + 
 +- install "docker" tool [[https://www.docker.com/get-started|here]]\\ 
 +- install a Galaxy server into Docker and run docker, by typing this single command: 
 + 
 +<code>docker run -p 8080:80 quay.io/galaxy/metagenomics-training</code> 
 + 
 +Wait a loooong time before it starts : 5-10 Go to download the first time! => do it at home using a fast internet connection. Further starts are faster (re type the same command to enable the server).  
 + 
 +- Go here in your browser : http://localhost:8080 
 + 
 +__pro__: fast server, depending of you computer power. Reusable.\\ 
 +__cons__: harder (and long) to install. Take some disk space onto your hard drive. 
 + 
 +  * Create a personal account into Galaxy (top-right menu)  
 + 
 +  * Start this tutorial [[http://www.bioinfomed.fr/__Teachings/tuto_Galaxy_metaG/index.html|Here]] //([[https://galaxyproject.github.io/training-material/topics/metagenomics/tutorials/mothur-miseq-sop-short/tutorial.html|alternative link]])//
  
teachings/tuto_16s_microbial_analysis.1581092484.txt.gz · Last modified: 2020/02/07 17:21 by olivier