Differences

This shows you the differences between two versions of the page.

--- teachings:tuto_16s_microbial_analysis [2020/02/07 17:21] – olivier
+++ teachings:tuto_16s_microbial_analysis [2022/10/13 14:12] (current) – olivier
@@ Line 1: / Line 1: @@
 ==== 16S Microbial Analysis (with Galaxy) ====
-This tutorial required:
+__This tutorial required__:
-  * a computer (under Linux, Mac, Windows) with an internet connection
+  * a computer (under Linux, Mac, Windows) **with** an internet connection
+  * To know what a fasta or fastq (fastaq = fq) file is
+ <hidden Click here for the fasta format description>
+Data in text format used to store nucleic acid sequences (such as DNA sequences) or protein sequences; may contain multiple sequences. FASTA files often start with a header line that may contain comments or other information. The rest of the file contains sequence data. Each sequence starts with a ">" symbol followed by the name of the sequence. The rest of the line describes the sequence and the remaining lines contain the sequence itself. \\ \\ Example of a fasta file including 2 sequences:\\ \\
-  * an access to a Galaxy website server (many are available freely) \\ \\ => See what is the Galaxy project: [[https://en.wikipedia.org/wiki/Galaxy_%28computational_biology%29|Wikipedia]] or [[https://usegalaxy.org/|Official website]]
+//>human_T1 (UCSC April 2002 chr7:115977709:)\\
+TTGTCAGATTCACCAAAGTTGAAATGAAGGAAAAAATGCTAAGGGCAGCC\\
+AGAGAGAGGTCAGGTTACCCACAAAGGGAAGCCCATCAGACTAACAGCG\\
+ATCTCTCGGCAGAAACCCTACAGGCCAGAAGAGAGTGGGGGCCAATATT\\
+CATATTCTTAAAGAAAAGAATTTTCAACCCAGAATTTCATATCCAGCCAA\\
+>human_T2 (UCSC April 2002 chr5:11977710:)\\
+ATACGACYCTTATTGTTAGTATATAATTTATATGAAAACMAAAAATTATG\\
+GCGGTATTTTAAGCTTTTCAGAGGAATTTGCTCTTTAATGGATAAAAC\\
+CTAAATCTTACTAGAATTAGTAAAGCAGTTTGTATACCACT\\ \\
+//
+</hidden>
+\\
+  * an access to a Galaxy website server, including usual tools for metagenomic analysis
+See what is the Galaxy project: [[https://en.wikipedia.org/wiki/Galaxy_%28computational_biology%29|Wikipedia]] or [[https://usegalaxy.org/|Official website]]
 {{ :teachings:galaxy.png?400 |}}
+//Example of the main display page of Galaxy (using a browser)//
+=> __3 possibilities to get access to a Galaxy server__:
+ **1)** Use a free distant server
+Many public Galaxy servers are available. Here a list of servers including the required metaG tools (//list updated November 2022//):
+https://africa.usegalaxy.eu/ \\
+https://india.usegalaxy.eu/ \\
+https://ecology.usegalaxy.eu/ \\
+https://galaxy.genouest.org/ \\
+https://metagenomics.usegalaxy.eu/ \\
+https://streetscience.usegalaxy.eu/ \\
+https://usegalaxy.be/ \\
+https://usegalaxy.eu/ \\
+https://usegalaxy.fr/ \\
+https://usegalaxy.no/ \\
+https://usegalaxy.org/ \\
+https://usegalaxy.org.au/
+__pro__: no installation required, usable directly \\
+__cons__: some limitations and slow (or super slow) when running big computations
+ **2)** Use our local Galaxy server (IRCAN institute, in Pasteur tower)
+ http://galaxy-metag.ircan.org/
+__pro__: no installation required, usable directly\\
+__cons__: should to be faster than previous servers, but depending the number of students connected at the same time !
+ **3)** Install Galaxy on your own computer
+- install "docker" tool [[https://www.docker.com/get-started|here]]\\
+- install a Galaxy server into Docker and run docker, by typing this single command:
+<code>docker run -p 8080:80 quay.io/galaxy/metagenomics-training</code>
+Wait a loooong time before it starts : 5-10 Go to download the first time! => do it at home using a fast internet connection. Further starts are faster (re type the same command to enable the server).
+- Go here in your browser : http://localhost:8080
-  * Create an account on of these Galaxy server : \\ \\ https://usegalaxy.org.au/login \\ https://usegalaxy.eu/login\\ https://nanopore.usegalaxy.eu/login\\   https://ecology.usegalaxy.eu/login \\ * google it for others servers !
+__pro__: fast server, depending of you computer power. Reusable.\\
+__cons__: harder (and long) to install. Take some disk space onto your hard drive.
-  * To know what a fasta or fastq (fastaq = fq) file is :
+--------
+then,
-//Data in text format used to store nucleic acid sequences (such as DNA sequences) or protein sequences; may contain multiple sequences. FASTA files often start with a header line that may contain comments or other information. The rest of the file contains sequence data. Each sequence starts with a ">" symbol followed by the name of the sequence. The rest of the line describes the sequence and the remaining lines contain the sequence itself.// Example : \\ \\ <nowiki>
->human_T1 (UCSC April 2002 chr7:115977709:)
-TTGTCAGATTCACCAAAGTTGAAATGAAGGAAAAAATGCTAAGGGCAGCC
-AGAGAGAGGTCAGGTTACCCACAAAGGGAAGCCCATCAGACTAACAGCG
-ATCTCTCGGCAGAAACCCTACAGGCCAGAAGAGAGTGGGGGCCAATATT
-CATATTCTTAAAGAAAAGAATTTTCAACCCAGAATTTCATATCCAGCCAA
-</nowiki>
-<nowiki>
+  * Create a personal account into Galaxy (top-right menu)
->human_T2 (UCSC April 2002 chr5:11977710:)
-ATACGACYCTTATTGTTAGTATATAATTTATATGAAAACMAAAAATTATG
-GCGGTATTTTAAGCTTTTCAGAGGAATTTGCTCTTTAATGGATAAAAC
-CTAAATCTTACTAGAATTAGTAAAGCAGTTTGTATACCACT
-</nowiki>
-  * Start this tutrorial : [[https://galaxyproject.github.io/training-material/topics/metagenomics/tutorials/mothur-miseq-sop-short/tutorial.html|here]]
+  * Start this tutorial : [[http://www.bioinfomed.fr/__Teachings/tuto_Galaxy_metaG/index.html|Here]] //([[https://galaxyproject.github.io/training-material/topics/metagenomics/tutorials/mothur-miseq-sop-short/tutorial.html|alternative link]])//

bioinfomed

User Tools

Site Tools

Differences

Page Tools