This shows you the differences between two versions of the page.
Both sides previous revisionPrevious revisionNext revision | Previous revision | ||
teachings:tuto_16s_microbial_analysis [2020/02/07 17:21] – olivier | teachings:tuto_16s_microbial_analysis [2025/02/10 10:20] (current) – olivier | ||
---|---|---|---|
Line 1: | Line 1: | ||
==== 16S Microbial Analysis (with Galaxy) ==== | ==== 16S Microbial Analysis (with Galaxy) ==== | ||
- | This tutorial | + | __This |
- | * a computer (under Linux, Mac, Windows) with an internet connection | + | * a computer (under Linux, Mac, Windows) |
+ | |||
+ | * To know what a fasta or fastq (fastaq = fq) file is | ||
+ | < | ||
+ | Data in text format used to store nucleic acid sequences (such as DNA sequences) or protein sequences; may contain multiple sequences. FASTA files often start with a header line that may contain comments or other information. The rest of the file contains sequence data. Each sequence starts with a ">" | ||
- | | + | //> |
+ | TTGTCAGATTCACCAAAGTTGAAATGAAGGAAAAAATGCTAAGGGCAGCC\\ | ||
+ | AGAGAGAGGTCAGGTTACCCACAAAGGGAAGCCCATCAGACTAACAGCG\\ | ||
+ | ATCTCTCGGCAGAAACCCTACAGGCCAGAAGAGAGTGGGGGCCAATATT\\ | ||
+ | CATATTCTTAAAGAAAAGAATTTTCAACCCAGAATTTCATATCCAGCCAA\\ | ||
+ | > | ||
+ | ATACGACYCTTATTGTTAGTATATAATTTATATGAAAACMAAAAATTATG\\ | ||
+ | GCGGTATTTTAAGCTTTTCAGAGGAATTTGCTCTTTAATGGATAAAAC\\ | ||
+ | CTAAATCTTACTAGAATTAGTAAAGCAGTTTGTATACCACT\\ \\ | ||
+ | // | ||
+ | |||
+ | </ | ||
+ | \\ | ||
+ | | ||
+ | |||
+ | See what is the Galaxy project: [[https:// | ||
{{ : | {{ : | ||
+ | //Example of the main display page of Galaxy (using a browser)// | ||
+ | |||
+ | => __3 possibilities to get access to a Galaxy server__: | ||
+ | |||
+ | | ||
+ | |||
+ | Many public Galaxy servers are available. Here a list of servers including the required metaG tools (//list updated October 2024//): | ||
+ | |||
+ | https:// | ||
+ | https:// | ||
+ | https:// | ||
+ | https:// | ||
+ | https:// | ||
+ | |||
+ | https:// | ||
+ | https:// | ||
+ | |||
+ | https:// | ||
+ | https:// | ||
+ | https:// | ||
+ | https:// | ||
+ | |||
+ | __pro__: no installation required, usable directly \\ | ||
+ | __cons__: some limitations and slow (or super slow) when running big computations | ||
+ | |||
+ | | ||
+ | |||
+ | | ||
+ | |||
+ | __pro__: no installation required, usable directly\\ | ||
+ | __cons__: should to be faster than previous servers, but depending the number of students connected at the same time ! | ||
+ | |||
+ | | ||
+ | |||
+ | - install " | ||
+ | - install a Galaxy server into Docker and run docker, by typing this single command: | ||
+ | |||
+ | < | ||
+ | |||
+ | Wait a loooong time before it starts : 5-10 Go to download the first time! => do it at home using a fast internet connection. Further starts are faster (re type the same command to enable the server). | ||
+ | |||
+ | - Go here in your browser : http:// | ||
+ | |||
+ | __pro__: fast server, depending of you computer power. Reusable.\\ | ||
+ | __cons__: harder (and long) to install. Take some disk space onto your hard drive. | ||
+ | |||
+ | -------- | ||
+ | then, | ||
- | * Create an account on of these Galaxy server : \\ \\ https:// | ||
- | * To know what a fasta or fastq (fastaq = fq) file is : | + | * Create |
- | //Data in text format used to store nucleic acid sequences (such as DNA sequences) or protein sequences; may contain multiple sequences. FASTA files often start with a header line that may contain comments or other information. The rest of the file contains sequence data. Each sequence starts with a ">" | + | * Start tutorial |
- | > | + | |
- | TTGTCAGATTCACCAAAGTTGAAATGAAGGAAAAAATGCTAAGGGCAGCC | + | |
- | AGAGAGAGGTCAGGTTACCCACAAAGGGAAGCCCATCAGACTAACAGCG | + | |
- | ATCTCTCGGCAGAAACCCTACAGGCCAGAAGAGAGTGGGGGCCAATATT | + | |
- | CATATTCTTAAAGAAAAGAATTTTCAACCCAGAATTTCATATCCAGCCAA | + | |
- | </ | + | |
- | < | + | - 16S with Illumina data : |
- | > | + | [[http:// |
- | ATACGACYCTTATTGTTAGTATATAATTTATATGAAAACMAAAAATTATG | + | |
- | GCGGTATTTTAAGCTTTTCAGAGGAATTTGCTCTTTAATGGATAAAAC | + | |
- | CTAAATCTTACTAGAATTAGTAAAGCAGTTTGTATACCACT | + | |
- | </nowiki> | + | |
- | * Start this tutrorial | + | - 16S with Nanopore data: |
+ | [[https://training.galaxyproject.org/ | ||